Convenience REST API

Convenience Create Methods

/data/post/create/conveniencePart

Used to create a Part consisting of a BioDesign and Part. Optionally, may also create a Sequence, Feature, BasicModule, Parameters, and an Annotation.

Upon success, the request will return the ID of the Part's BioDesign, which can be used to retrieve/query for all sub-objects.

Body

{
    'username':'string',
    'objectName':'string',
    'displayID':'string',
    'sequence':'string',
    'role':'string',
    'params':[
    	{
            'name':'string',
            'value':'double',
            'variable':'string',
            'units':'string'
        },
        ...
    ]

}

Field	Optional	Description
username	Required	User or author creating the part
objectName	Required	Name of the part being created. For every object created for the Part, they will share this name (BioDesign, Part, Sequence, etc).
displayID	Optional	A human-friendly ID, can be used to differentiate between similarly named objects. Attached to all created sub-objects
sequence	Optional (Required if role is used)	DNA sequence associated with the Part being created.
role	Optional (Required if sequence is used)	The role of the part or sequence being created.
params	Optional	An array of Parameter objects to be associated with the Part. Each parameter is defined by 4 fields: name, value, variable, and units

Example Bodys:

https://localhost:8443/data/post/create/conveniencePart

{
   'username':'mardian',
   'objectName':'p001',
   'sequence':'ATGACTGCTACTAGCGACAAAGTACTAAAGATTCAATTGCGCTCAGCAAGCGCTACTGTACCTACCAAAGGTTCTGCCACTGCCGCGGGATACGACATTTATGCATCTCAGGATATTACCATTCCGGCTATGGGTCAAGGTATGGTTTCCACCGACATATCGTTCACCGTACCTGTTGGTACCTACGGTCGTATTGCGCCAAGGTCAGGCCTGGCAGTGAAAAACGGTATCCAAACCGGTGCTGGTGTTGTCGACAGAGATTACACCGGTGAAGTTAAAGTAGTTTTATTCAATCATTCACAGAGGGATTTCGCGATCAAAAAAGGTGATCGCGTAGCCCAATTGATTCTGGAAAAAATTGTCGATGATGCCCAGATCGTTGTTGTAGACTCTCTGGAAGAAAGTGCAAGAGGGGCCGGTGGCTTTGGTAGCACTGGTAACTAA',
   'role':'CDS',
   'params':[

   ]
}

{
    'username':'djtran',
    'objectName':'YFP',
    'sequence':'atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccacaggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacaccccaatcggcgacggccccgtgctgctgcccgacaaccactaccttagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa',
    'role':'CDS',
    'params':[
    	{
            'name':'YFP Degradation Rate',
            'value':'0.075',
            'variable':'rate',
            'units':'second-1',
        }
    ]
}

/data/post/create/convenienceDevice

Used to create a Device consisting of a BioDesign, Part, and Assembly. Optionally, may also create a Sequence, Feature, BasicModule, Parameters, and Annotations. The array of supplied Part IDs are linked to the BioDesign as sub-designs, to the Assembly, and Annotations may be created if those parts are found within the Sequence of the Device.

Upon success, the request will return the ID of the Part's BioDesign, which can be used to retrieve/query for all sub-objects.

Body

{
    'username':'string',
    'objectName':'string',
    'displayID':'string',
    'sequence':'string',
    'role':'string',
    'params':[
    	{
            'name':'string',
            'value':'double',
            'variable':'string',
            'units':'string'
        },
        ...
    ],
    'createSeqFromParts': 'false',
    'partIDs': 'string'
}

Field	Optional	Description
username	Required	User or author creating the part
objectName	Required	Name of the part being created. For every object created for the Part, they will share this name (BioDesign, Part, Sequence, etc).
createSeqFromParts	Required	If no sequence provided, true will cause the sequence to be created from the sequences of each part provided.
displayID	Optional	A human-friendly ID, can be used to differentiate between similarly named objects. Attached to all created sub-objects
sequence	Optional (Required if role is used)	DNA sequence associated with the Part being created.
role	Optional (Required if sequence is used)	The role of the part or sequence being created.
params	Optional	An array of Parameter objects to be associated with the Part. Each parameter is defined by 4 fields: name, value, variable, and units
partIDs	Optional	String consisting of part IDs delimited by commas. Example: '58f41f1a8aec4c36909b0730, 58f41f1b8aec4c36909b0734, 58f41f1b8aec4c36909b073e'

Example Bodys:

https://localhost:8443/data/post/create/convenienceDevice

{
  'username': 'djtran',
  'objectName': 'Lacl Sensor',
  'sequence': 'aacgatcgttggctgtgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcgctcacaattatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccacaggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacaccccaatcggcgacggccccgtgctgctgcccgacaaccactaccttagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa',
  'role': 'PROMOTER',
  'params': [
    {
      'name': 'Lacl-GFP Sensitivity',
      'value': '0.1',
      'variable': 'sensitivity',
      'units': ''
    }
  ],
  'createSeqFromParts': 'false',
  'partIDs': '58f41f1a8aec4c36909b0730, 58f41f1b8aec4c36909b0734, 58f41f1b8aec4c36909b073e'
}

/data/post/get/conveniencePart

Body

{
    'username':'string',
    'objectName':'string',
    'displayID':'string',
    'sequence':'string',
    'role':'string',
    'params':[
    	{
            'name':'string',
            'value':'double',
            'variable':'string',
            'units':'string'
        },
        ...
    ],
}

Field	Optional	Description
objectName	Optional	The name of the Part, a substring of the name, or any regex string to search for the name.
displayID	Optional	The displayID of the Part, a substring, or any regex match
sequence	Optional	DNA sequence associated with the Part being created.
role	Optional	The role of the part or sequence being created.
params	Optional	An array of Parameter objects to be associated with the Part. Each parameter is defined by 4 fields: name, value, variable, and units

/data/post/get/convenienceDevice

Body

{
    'username':'string',
    'objectName':'string',
    'displayID':'string',
    'sequence':'string',
    'role':'string',
    'params':[
    	{
            'name':'string',
            'value':'double',
            'variable':'string',
            'units':'string'
        },
        ...
    ],
    'parts': [
    	{
            'name':'string',
            'description':'double'
        },
        ...
    ]
}

Field	Optional	Description
objectName	Optional	The name of the Device, a substring of the name, or any regex string to search for the name.
displayID	Optional	The displayID of the Device, a substring, or any regex match.
sequence	Optional	The sequence of the Device, a substring, or any regex match.
role	Optional	The role of the Device, a substring, or any regex match.
parts	Optional	A list containing Part objects that must be included as sub-Parts in the Parts returned. Note that the Part objects do not need to have the same Id as the corresponding object attached to the Device, the only requirement is that all the fields match, are a substring, or are a regex match.
params	Optional	An array of Parameter objects that are associated with the Device. Each parameter is defined by 4 fields: name, value, variable, and units.