New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

extract: Outputs blank lines #48

Open

sjackman opened this issue Jan 14, 2019 · 1 comment

Contributor

sjackman commented Jan 14, 2019 •

edited

Loading

gfak extract outputs blank lines. For example:

>7
CTCTTTTTTATTATAATGAAATTTGATTAGTAATAATTCTATTTTATTGTATTAAAAAACAAACTAC

>8
GGGTTTATTTGATCAATTTTTGCAATCAATTTCTTGAAACCG

>9
AGTATTGAATAAATACTATTTTGAATTAAAGAA

There are typically no blank lines in a FASTA file.

The text was updated successfully, but these errors were encountered:

Owner

edawson commented Jan 21, 2019

This is fixed in the latest release but hasn't made it to homebrew quite yet. I'll close once it's resolved globally!

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment