ClothoEdit.txt

ClothoEdit.txt 
Author: Jason Lu (jasonlu6@bu.edu) 

# this file was made to assure alignment for my code, 
# which is made as a fix for the JSON Token Error
# from the RAML compiler. 

# Edit 1: homepage method 

properties:
 # username for Clotho
  username: string
 # password for Clotho
  password: string
example: |
    {
    "username": "jsmith",
    "password": "allstar"
    }

# Edit 2: createPart method 

properties:
 # username for Clotho
 # password for Clotho
 # object name to create
 # id to use for existing sequence
  username: string
  password: string
  objectName: string
  seqId: number
  example: |
   {
   "username": "jsmith",
   "password": "overwatch",
   "objectName": "Test Part",
   "seqId": 321
   }

# Edit 3: createConveniencePart 

properties:
 # username for Clotho
 # object name for Clotho to create
 # sequence to put into mongoDB
 # role for the sequence
  username: string
  objectName: string
  sequence: string
  roleSequence: string
  example: |
   {
   "username": "jsmith",
   "objectName": "Test Convenience Part",
   "sequence": "tccctatcagtgatagagattgacatccctatcagtgatagagatac",
   "roleSequence": "GENE"
   }

# Edit 4: createConvenienceDevice 

properties:
 # username for Clotho
 # object name for Clotho to create
 # sequence to put into mongoDB (may be duplicated)
 # role for the sequence
 # part-IDs: id for the part of device (array)
  username: string
  objectName: string
  sequence: string
  roleSequence: string

  example: |
   {
    "username": "jsmith",
    "objectName": "Test Convenience Device",
    "sequence": "actacttcgcatcatgttcatca",
    "roleSequence": "GENE"
    }